proISG15 C-term. domain (79-165)
(Plasmid
#110763)
-
PurposeBacterial expression of proISG15 C-term. domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerMerck
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameISG15
-
SpeciesH. sapiens (human)
-
Entrez GeneISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
- Promoter T7
-
Tag
/ Fusion Protein
- N-His6-3C (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGGTTATGCTAGTTATTGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byISG15 gene obtained through gene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
proISG15 C-term. domain (79-165) was a gift from David Komander (Addgene plasmid # 110763 ; http://n2t.net/addgene:110763 ; RRID:Addgene_110763) -
For your References section:
Irreversible inactivation of ISG15 by a viral leader protease enables alternative infection detection strategies. Swatek KN, Aumayr M, Pruneda JN, Visser LJ, Berryman S, Kueck AF, Geurink PP, Ovaa H, van Kuppeveld FJM, Tuthill TJ, Skern T, Komander D. Proc Natl Acad Sci U S A. 2018 Mar 6;115(10):2371-2376. doi: 10.1073/pnas.1710617115. Epub 2018 Feb 20. 10.1073/pnas.1710617115 PubMed 29463763