Skip to main content
Addgene

ISG15 C-term. Domain intein/chitin binding domain (79-156)
(Plasmid #110760)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110760 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTXB1
  • Backbone manufacturer
    NEB
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ISG15
  • Species
    H. sapiens (human)
  • Entrez Gene
    ISG15 (a.k.a. G1P2, IFI15, IMD38, IP17, UCRP, hUCRP)
  • Promoter T7
  • Tag / Fusion Protein
    • intein/chitin binding domain (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ISG15 gene obtained through gene synthesis
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ISG15 C-term. Domain intein/chitin binding domain (79-156) was a gift from David Komander (Addgene plasmid # 110760 ; http://n2t.net/addgene:110760 ; RRID:Addgene_110760)

  • For your References section:

    Irreversible inactivation of ISG15 by a viral leader protease enables alternative infection detection strategies. Swatek KN, Aumayr M, Pruneda JN, Visser LJ, Berryman S, Kueck AF, Geurink PP, Ovaa H, van Kuppeveld FJM, Tuthill TJ, Skern T, Komander D. Proc Natl Acad Sci U S A. 2018 Mar 6;115(10):2371-2376. doi: 10.1073/pnas.1710617115. Epub 2018 Feb 20. 10.1073/pnas.1710617115 PubMed 29463763
Related items:
Commonly requested with: