Skip to main content
Addgene

Lbpro (29-195)
(Plasmid #110759)

Print

Ordering

This material is available to academics and nonprofits only. Availability may be limited outside the U.S. Please log in for more information.
Item Catalog # Description Quantity Price (USD)
Plasmid 110759 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET11d
  • Backbone manufacturer
    Merck
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Lb pro
  • Species
    Foot and mouth disease virus (FMDV)
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lbpro (29-195) was a gift from Tim Skern (Addgene plasmid # 110759 ; http://n2t.net/addgene:110759 ; RRID:Addgene_110759)

  • For your References section:

    Structure of the foot-and-mouth disease virus leader protease: a papain-like fold adapted for self-processing and eIF4G recognition. Guarne A, Tormo J, Kirchweger R, Pfistermueller D, Fita I, Skern T. EMBO J. 1998 Dec 15;17(24):7469-79. doi: 10.1093/emboj/17.24.7469. 10.1093/emboj/17.24.7469 PubMed 9857201
Related items:
Commonly requested with: