Skip to main content
Addgene

Human HUWE1 (3993-4374)
(Plasmid #110754)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110754 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    Merck
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HUWE1
  • Species
    H. sapiens (human)
  • Entrez Gene
    HUWE1 (a.k.a. ARF-BP1, HECTH9, HSPC272, Ib772, LASU1, MRXST, MULE, URE-B1, UREB1)
  • Promoter T7
  • Tag / Fusion Protein
    • N-His6-3C (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    HUWE1: cDNA plasmid (provided by Thomas Mund, LMB)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human HUWE1 (3993-4374) was a gift from David Komander (Addgene plasmid # 110754 ; http://n2t.net/addgene:110754 ; RRID:Addgene_110754)

  • For your References section:

    Ubiquitin Linkage-Specific Affimers Reveal Insights into K6-Linked Ubiquitin Signaling. Michel MA, Swatek KN, Hospenthal MK, Komander D. Mol Cell. 2017 Oct 5;68(1):233-246.e5. doi: 10.1016/j.molcel.2017.08.020. Epub 2017 Sep 21. 10.1016/j.molcel.2017.08.020 PubMed 28943312
Related items:
Commonly requested with: