Human USP30 (1-517, C77A, MG-38-16)
(Plasmid
#110749)
-
PurposeTransient transfection of human USP30 C77A
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTriEx2
-
Backbone manufacturerMerck
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUSP30
-
SpeciesH. sapiens (human)
-
MutationC77A
-
Entrez GeneUSP30
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATACGACTCACTATAGGG
- 3′ sequencing primer TCGATCTCAGTGGTATTTGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byUSP30 gene obtained through gene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human USP30 (1-517, C77A, MG-38-16) was a gift from David Komander (Addgene plasmid # 110749 ; http://n2t.net/addgene:110749 ; RRID:Addgene_110749) -
For your References section:
Mechanism and regulation of the Lys6-selective deubiquitinase USP30. Gersch M, Gladkova C, Schubert AF, Michel MA, Maslen S, Komander D. Nat Struct Mol Biol. 2017 Sep 25. doi: 10.1038/nsmb.3475. 10.1038/nsmb.3475 PubMed 28945249