pEN35-CDKN2A-Ex2-R
(Plasmid
#110737)
-
PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEN35
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDKN2A gRNA
-
gRNA/shRNA sequenceGACCCGTGCACGACGCTGCCCGG
-
SpeciesH. sapiens (human)
-
Entrez GeneCDKN2A (a.k.a. ARF, CAI2, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN35-CDKN2A-Ex2-R was a gift from Robert Judson-Torres (Addgene plasmid # 110737 ; http://n2t.net/addgene:110737 ; RRID:Addgene_110737) -
For your References section:
Bi-allelic Loss of CDKN2A Initiates Melanoma Invasion via BRN2 Activation. Zeng H, Jorapur A, Shain AH, Lang UE, Torres R, Zhang Y, McNeal AS, Botton T, Lin J, Donne M, Bastian IN, Yu R, North JP, Pincus L, Ruben BS, Joseph NM, Yeh I, Bastian BC, Judson RL. Cancer Cell. 2018 Jul 9;34(1):56-68.e9. doi: 10.1016/j.ccell.2018.05.014. 10.1016/j.ccell.2018.05.014 PubMed 29990501