pUCHR-CD5HA2-P2A-smAID-mClover
(Plasmid
#110658)
-
PurposeLentiviral vector expressing cell surface HA-tag and monomeric GFP N-terminaly fused with auxin inducible degron
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110658 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUCHR
- Total vector size (bp) 7493
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD5HA2-P2A-AID-mClover
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1125
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (not destroyed)
- 3′ cloning site Psp XI (not destroyed)
- 5′ sequencing primer CCACGCTGTTTTGACCTCCATAG
- 3′ sequencing primer GTGGCTAAGATCTACAGCTGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCHR-CD5HA2-P2A-smAID-mClover was a gift from Dmitriy Mazurov (Addgene plasmid # 110658 ; http://n2t.net/addgene:110658 ; RRID:Addgene_110658) -
For your References section:
Isolation of gene-edited cells via knock-in of short glycophosphatidylinositol-anchored epitope tags. Zotova A, Pichugin A, Atemasova A, Knyazhanskaya E, Lopatukhina E, Mitkin N, Holmuhamedov E, Gottikh M, Kuprash D, Filatov A, Mazurov D. Sci Rep. 2019 Feb 28;9(1):3132. doi: 10.1038/s41598-019-40219-z. 10.1038/s41598-019-40219-z PubMed 30816313