Skip to main content
Addgene

pJet-CMV-CD5cmyc2-bglpA
(Plasmid #110645)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110645 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pJet 1.2
  • Total vector size (bp) 4101
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CMV-CDcmyc2-bglpA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1130
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba I (not destroyed)
  • 3′ cloning site Kpn I (not destroyed)
  • 5′ sequencing primer AAGAACATCGATTTTCCATGGCAG
  • 3′ sequencing primer CGACTCACTATAGGGAGAGCGGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJet-CMV-CD5cmyc2-bglpA was a gift from Dmitriy Mazurov (Addgene plasmid # 110645 ; http://n2t.net/addgene:110645 ; RRID:Addgene_110645)

  • For your References section:

    Isolation of gene-edited cells via knock-in of short glycophosphatidylinositol-anchored epitope tags. Zotova A, Pichugin A, Atemasova A, Knyazhanskaya E, Lopatukhina E, Mitkin N, Holmuhamedov E, Gottikh M, Kuprash D, Filatov A, Mazurov D. Sci Rep. 2019 Feb 28;9(1):3132. doi: 10.1038/s41598-019-40219-z. 10.1038/s41598-019-40219-z PubMed 30816313
Related items: