Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3 Paf1
(Plasmid #11059)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11059 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Paf1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1596
  • Entrez Gene
    PAF1 (a.k.a. F23149_1, PD2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7
  • 3′ sequencing primer SP6
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGCCCACCATCCAG 3' and 5' CCGCTCGAGTCAGTCACTGTCACTATCAGCTTCACTG 3'

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 Paf1 was a gift from Matthew Meyerson (Addgene plasmid # 11059 ; http://n2t.net/addgene:11059 ; RRID:Addgene_11059)
  • For your References section:

    The parafibromin tumor suppressor protein is part of a human Paf1 complex. Rozenblatt-Rosen O, Hughes CM, Nannepaga SJ, Shanmugam KS, Copeland TD, Guszczynski T, Resau JH, Meyerson M. Mol Cell Biol. 2005 Jan . 25(2):612-20. 10.1128/MCB.25.2.612-620.2005 PubMed 15632063