Skip to main content
Addgene

pJM230 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD-stRBS-lacZ)
(Plasmid #110560)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110560 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJM220 (Addgene plasmid #110559)
  • Backbone manufacturer
    Joanna Goldberg (Addgene plasmid #110559)
  • Backbone size w/o insert (bp) 6700
  • Vector type
    Bacterial Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    stRBS-lacZ
  • Promoter rhaSR-PrhaBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer oJM730 (gatacagcgtgaattttcagg)
  • 3′ sequencing primer Tn7-end (GGGGTGGAAATGGAGTTTTT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM230 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD-stRBS-lacZ) was a gift from Joanna Goldberg (Addgene plasmid # 110560 ; http://n2t.net/addgene:110560 ; RRID:Addgene_110560)
  • For your References section:

    The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa. Meisner J, Goldberg JB. Appl Environ Microbiol. 2016 Oct 27;82(22):6715-6727. doi: 10.1128/AEM.02041-16. Print 2016 Nov 15. 10.1128/AEM.02041-16 PubMed 27613678