pCK306
(Plasmid #110544)

• Purpose: rhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.
• Depositing Lab: John Heap
• Publication: Kelly et al ACS Synth Biol. 2018 Apr 2. doi: 10.1021/acssynbio.7b00435.

Backbone

• Vector backbone: pACYC177
• Backbone size w/o insert (bp): 3941
• Total vector size (bp): 6059
• Modifications to backbone: Addition of two 1000bp sequences with homology to the Synechocystis sp. PCC6803 genome, allowing chromosomal integration. Introduction of the rhaBAD promoter from E. coli (allowing inducible expression with L-rhamnose). Introduction of a synthetic RBS and yfp as a reporter. Introduction of rhaS gene from E. coli, the transcriptional activator required for rhaBAD function in Synechocystis.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: PrhaBAD
• Alt name: promoter found 5' end of rhaBAD operon in E. coli
• Species: E. coli
• Insert Size (bp): 122
• Promoter: N/A

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGCAAACAGGAGAAACTCC

Gene/Insert 2

• Gene/Insert name: yfp
• Alt name: enhanced yellow fluorescent protein from A. victoria (BBa_E0030)
• Species: A. victoria
• Insert Size (bp): 720
• Promoter: PrhaBAD

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ttcatctttccctggttgccaatgg

Gene/Insert 3

• Gene/Insert name: rhaS
• Alt name: transcriptional activator of the rhaBAD promoter in E. coli with native E. coli RBS
• Species: E. coli
• Insert Size (bp): 837
• Promoter: kanR promoter (upstream of kanR, immediately before rhaS)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTGATGTTGGACGAGTCGG

Resource Information

• Supplemental Documents:
  • pCK306.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry