-
PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepACYC177
- Backbone size w/o insert (bp) 3941
- Total vector size (bp) 6059
-
Modifications to backboneAddition of two 1000bp sequences with homology to the Synechocystis sp. PCC6803 genome, allowing chromosomal integration. Introduction of the rhaBAD promoter from E. coli (allowing inducible expression with L-rhamnose). Introduction of a synthetic RBS and yfp as a reporter. Introduction of rhaS gene from E. coli, the transcriptional activator required for rhaBAD function in Synechocystis.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePrhaBAD
-
Alt namepromoter found 5' end of rhaBAD operon in E. coli
-
SpeciesE. coli
-
Insert Size (bp)122
- Promoter N/A
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGCAAACAGGAGAAACTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameyfp
-
Alt nameenhanced yellow fluorescent protein from A. victoria (BBa_E0030)
-
SpeciesA. victoria
-
Insert Size (bp)720
- Promoter PrhaBAD
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ttcatctttccctggttgccaatgg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namerhaS
-
Alt nametranscriptional activator of the rhaBAD promoter in E. coli with native E. coli RBS
-
SpeciesE. coli
-
Insert Size (bp)837
- Promoter kanR promoter (upstream of kanR, immediately before rhaS)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTGATGTTGGACGAGTCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCK306 was a gift from John Heap (Addgene plasmid # 110544 ; http://n2t.net/addgene:110544 ; RRID:Addgene_110544) -
For your References section:
A Rhamnose-Inducible System for Precise and Temporal Control of Gene Expression in Cyanobacteria. Kelly CL, Taylor GM, Hitchcock A, Torres-Mendez A, Heap JT. ACS Synth Biol. 2018 Apr 2. doi: 10.1021/acssynbio.7b00435. 10.1021/acssynbio.7b00435 PubMed 29544054