pET22b-ecDHFR-dCys-L54C
(Plasmid
#110542)
-
PurposeBacterial expression of E.coli DHFR C85A/C152S/L54C mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET22b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5493
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameecDHFR
-
Alt namedihydrofolate reductase
-
Alt namefolA
-
SpeciesE.coli
-
Insert Size (bp)480
-
MutationL54 mutated to C54, C85 mutated to A85, C152 mutated to S152
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-ecDHFR-dCys-L54C was a gift from Stephen Benkovic (Addgene plasmid # 110542 ; http://n2t.net/addgene:110542 ; RRID:Addgene_110542) -
For your References section:
Probing the electrostatics of active site microenvironments along the catalytic cycle for Escherichia coli dihydrofolate reductase. Liu CT, Layfield JP, Stewart RJ 3rd, French JB, Hanoian P, Asbury JB, Hammes-Schiffer S, Benkovic SJ. J Am Chem Soc. 2014 Jul 23;136(29):10349-60. doi: 10.1021/ja5038947. Epub 2014 Jul 11. 10.1021/ja5038947 PubMed 24977791