pcDNA3 HRPT2 227X
(Plasmid #11050)

• Depositing Lab: Matthew Meyerson
• Publication: Rozenblatt-Rosen et al Mol Cell Biol. 2005 Jan . 25(2):612-20.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HRPT2 227X
• Alt name: HRPT2 679x
• Alt name: HRPT2
• Alt name: parafibromin
• Species: H. sapiens (human)
• Insert Size (bp): 679
• Mutation: truncation mutant with a stop codon introduced at 679bp (stops at aa227).
• Entrez Gene: CDC73 (a.k.a. C1orf28, FIHP, HPTJT, HRPT1, HRPT2, HYX)
• Tag / Fusion Protein:
  • flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: T7
• 3′ sequencing primer: SP6

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGTCAGCTGACAATATCTCGGGTCAC 3' and ligated into pcDNA3 HRPT2 that had been digested with BamHI & XhoI (which removes full-length HRPT2, but leaves the flag tag at the N-terminus. See plasmid 11048 to learn how pcDNA3 HRPT2 was constructed).