H52-pUCM-hNGN2-inv
(Plasmid #110492)

• Purpose: Donor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuron, TALEN cut site outside of homology arm
• Depositing Lab: Michael Ward
• Publication: A comprehensive guide for transcription-factor mediated differentiation of human iPSC into neurons (unpublished)

Backbone

• Vector backbone: pUCM
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 10709
• Vector type: Mammalian Expression, Cre/Lox, CRISPR, TALEN
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Neurogenin 2
• Alt name: NGN2
• Species: H. sapiens (human)
• Insert Size (bp): 819
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG

Gene/Insert 2

• Gene/Insert name: mcherry
• Alt name: mcherry
• Species: synthetic
• Insert Size (bp): 702
• Promoter: EF-1 alpha

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcgcctacgctagcgctac

Gene/Insert 3

• Gene/Insert name: rtTA3G
• Alt name: rtTA3G
• Insert Size (bp): 747
• Promoter: CAG

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctggttattgtgctgtctc

Resource Information

• Supplemental Documents:
  • H52-pUCM-hNGN2-inv.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry