pBMN-mEGFP-C1
(Plasmid
#110468)
-
Purposeretrovirus construct for stable expressing mEGFP tagged protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBMN-Z
-
Backbone manufacturerOrbigen
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 5747
-
Modifications to backboneLacZ is removed
-
Vector typeMammalian Expression, Retroviral ; retrovirus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEGFP
-
SpeciesSynthetic
-
Insert Size (bp)777
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCTCAAAGTAGACGGCATC
- 3′ sequencing primer AGGTGGGGTCTTTCATTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBMN-mEGFP-C1 was a gift from Richard Youle (Addgene plasmid # 110468 ; http://n2t.net/addgene:110468 ; RRID:Addgene_110468) -
For your References section:
The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris DP, Fogel AI, Youle RJ. Nature. 2015 Aug 20;524(7565):309-14. doi: 10.1038/nature14893. Epub 2015 Aug 12. 10.1038/nature14893 PubMed 26266977