Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBMN-mEGFP-C1
(Plasmid #110468)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110468 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBMN-Z
  • Backbone manufacturer
    Orbigen
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 5747
  • Modifications to backbone
    LacZ is removed
  • Vector type
    Mammalian Expression, Retroviral ; retrovirus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEGFP
  • Species
    Synthetic
  • Insert Size (bp)
    777
  • Tag / Fusion Protein
    • mEGFP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCTCAAAGTAGACGGCATC
  • 3′ sequencing primer AGGTGGGGTCTTTCATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBMN-mEGFP-C1 was a gift from Richard Youle (Addgene plasmid # 110468 ; http://n2t.net/addgene:110468 ; RRID:Addgene_110468)
  • For your References section:

    The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris DP, Fogel AI, Youle RJ. Nature. 2015 Aug 20;524(7565):309-14. doi: 10.1038/nature14893. Epub 2015 Aug 12. 10.1038/nature14893 PubMed 26266977