pLKO.1-blast shKGA
(Plasmid
#110420)
-
PurposeshKGA, silence glutaminase KGA isoform, blasticidin selection.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1-blast
-
Backbone manufacturer#26655
- Backbone size w/o insert (bp) 6783
- Total vector size (bp) 6813
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGLS glutaminase
-
Alt nameKGA isoform
-
gRNA/shRNA sequenceACAGCGGGACTATGATTCT
-
SpeciesH. sapiens (human)
-
Entrez GeneGLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
- Promoter U6 (RNA Pol III)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5' GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.
Plasmid grows more slowly than standard plasmids.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-blast shKGA was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110420 ; http://n2t.net/addgene:110420 ; RRID:Addgene_110420)