pLKO.1-blast shKGA
(Plasmid #110420)

• Purpose: shKGA, silence glutaminase KGA isoform, blasticidin selection.
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: Dias lab diverse plasmid collection (unpublished)

Backbone

• Vector backbone: pLKO.1-blast
• Backbone manufacturer: #26655
• Backbone size w/o insert (bp): 6783
• Total vector size (bp): 6813
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GLS glutaminase
• Alt name: KGA isoform
• gRNA/shRNA sequence: ACAGCGGGACTATGATTCT
• Species: H. sapiens (human)
• Entrez Gene: GLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
• Promoter: U6 (RNA Pol III)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: LKO.1 5' GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • pD182-pLKO.1-blast shKGA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.

Plasmid grows more slowly than standard plasmids.