pcDNA3.1D V5-His-TOPO-HuR.wt
(Plasmid
#110417)
-
PurposeMammalian expression of HuR (wild type)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1D/V5-His-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5514
- Total vector size (bp) 6495
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHuR (ELAVL1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)978
-
Entrez GeneELAVL1 (a.k.a. ELAV1, HUR, Hua, MelG)
- Promoter CMV
-
Tags
/ Fusion Proteins
- V5 (C terminal on backbone)
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1D V5-His-TOPO-HuR.wt was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110417 ; http://n2t.net/addgene:110417 ; RRID:Addgene_110417)