pX330.puro
(Plasmid #110403)

• Purpose: (Empty Backbone) CRISPR/Cas9 vector with sgRNA expression and puromycin resistance
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: HuR (ELAVL1) silencing sensitizes triple-negative breast cancer to glutaminase-targeted therapy (unpublished)

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Backbone manufacturer: #42230
• Backbone size (bp): 8506
• Modifications to backbone: NotI site cleaved and filled, SV40-Puro cassete from pBABE.puro (Addgene #1764 from Dr. Hartmut Land, Dr. Jay Morgenstern, Dr. Bob Weinberg) with BamHI (overhang removed) and XbaI (overhang filled).
• Vector type: Mammalian Expression, CRISPR
• Promoter: CBh
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • pD082-pX330.puro.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pX330 with puromycin resistance

For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/