pQC V5 MCS IRES Puro
(Plasmid #110342)

• Purpose: (Empty Backbone) γ-Retroviral transfer vector for cloning and expressing your gene of interest. V5 N-Terminal tag, IRES-driven Puromycin selection.
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: Mammalian retroviral expression plasmids based on pQC family (unpublished)

Backbone

• Vector backbone: pQC MCS IRES Puro
• Backbone manufacturer: #110343
• Backbone size (bp): 7067
• Modifications to backbone: V5 tag were added over BamHI site (without destruction at 3') with annealed oligos (5' GATCACCATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGG 3' and 5' GATCCCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCCATGGT 3')
• Vector type: Mammalian Expression, Retroviral
• Promoter: CMV
• Selectable markers: Puromycin
• Tag / Fusion Protein:
  • V5 (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pQC Seq Fow 5'-ACGCCATCCACGCTGTTTTGACCT-3'
• 3′ sequencing primer: pQC Seq Rev 5'-AAGCGGCTTCGGCCAGTAACGTTA-3'

Resource Information

• Supplemental Documents:
  • pD007-pQC V5 MCS IRES Puro.gb
• A portion of this plasmid was derived from a plasmid made by: Used sequences from pQC mKorange IX (Addgene #37344), Dr. Connie Cepko and pLKO.1 - TRC cloning vector (Addgene #10878), Dr. David Root

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pQC-based γ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Puromycin selection.

Also available as:
V5-mKO2-MCS-IRES-Puro (Addgene #110341)
V5 MCS IRES Puro (Addgene #110342)
MCS IRES Puro (Addgene #110343)
MCS IRES G418 (Addgene #110344)
V5 MCS IRES G418 (Addgene #110345)

All vectors can be used for TA-cloning (After XcmI cleavage), or BamHI-AgeI-PmeI-EcoRI restriction cloning.

Weinberg Lab recommends using pUMVC (Addgene #8449) and VSV-G (#8454) for packaging.