Skip to main content
Addgene

pLKO.puro_shGLS
(Plasmid #110335)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110335 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet-pLKO-puro
  • Backbone manufacturer
    #21915
  • Backbone size w/o insert (bp) 8901
  • Total vector size (bp) 7080
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GLS glutaminase
  • Alt name
    glutaminase
  • gRNA/shRNA sequence
    CAACTGGCCAAATTCAGTC
  • Species
    H. sapiens (human), Synthetic
  • GenBank ID
    2744
  • Entrez Gene
    GLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
  • Promoter U6 (RNA PolIII)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5' GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.

Plasmid grows more slowly than standard plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.puro_shGLS was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110335 ; http://n2t.net/addgene:110335 ; RRID:Addgene_110335)
  • For your References section:

    GLS2 is protumorigenic in breast cancers. Dias MM, Adamoski D, Dos Reis LM, Ascencao CFR, de Oliveira KRS, Mafra ACP, da Silva Bastos AC, Quintero M, de G Cassago C, Ferreira IM, Fidelis CHV, Rocco SA, Bajgelman MC, Stine Z, Berindan-Neagoe I, Calin GA, Ambrosio ALB, Dias SMG. Oncogene. 2020 Jan;39(3):690-702. doi: 10.1038/s41388-019-1007-z. Epub 2019 Sep 20. 10.1038/s41388-019-1007-z PubMed 31541193