pcDNA3.1D V5-His-TOPO-KGA.wt
(Plasmid #110332)

• Purpose: Mammalian expression of glutaminase isoform KGA (wild type) with V5 and 6xHis tags
• Depositing Lab: Sandra Martha Gomes Dias
• Publication: Cassago et al Proc Natl Acad Sci U S A. 2012 Jan 24;109(4):1092-7. doi: 10.1073/pnas.1112495109. Epub 2012 Jan 6.

Backbone

• Vector backbone: pcDNA3.1D/V5-His-TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5514
• Total vector size (bp): 7521
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KGA glutaminase
• Alt name: GLS (KGA Isoform)
• Species: H. sapiens (human)
• Insert Size (bp): 2007
• GenBank ID: 2744 NM_014905
• Entrez Gene: GLS (a.k.a. AAD20, CASGID, DEE71, EIEE71, GAC, GAM, GDPAG, GLS1, KGA)
• Promoter: CMV
• Tags / Fusion Proteins:
  • V5 (C terminal on backbone)
  • 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: CMV Forward 5' CGCAAATGGGCGGTAGGCGTG 3'

Resource Information

• Supplemental Documents:
  • pD158-pcDNA3.1D V5-His-TOPO-KGA.wt.gb
• A portion of this plasmid was derived from a plasmid made by: Dr. Richard Cerione

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry