Skip to main content
Addgene

pLKO.1-TRC.mKO2_shARL4C.1
(Plasmid #110320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110320 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1-TRC.mKO2
  • Backbone manufacturer
    #85208
  • Backbone size w/o insert (bp) 7032
  • Total vector size (bp) 7102
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARL4C
  • Alt name
    ADP ribosylation factor like GTPase 4C
  • gRNA/shRNA sequence
    GTCCCTGCATATCGTCATGTT
  • Species
    H. sapiens (human); Homo sapiens
  • GenBank ID
    10123 NM_001282431
  • Entrez Gene
    ARL4C (a.k.a. ARL7, LAK)
  • Promoter U6 (RNA Pol III)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Addgene's pLKO family protocol http://www.addgene.org/plko on how to use the pLKO family vectors.

Plasmid grows more slowly than standard plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-TRC.mKO2_shARL4C.1 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 110320 ; http://n2t.net/addgene:110320 ; RRID:Addgene_110320)
  • For your References section:

    Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer. Quintero M, Adamoski D, Reis LMD, Ascencao CFR, Oliveira KRS, Goncalves KA, Dias MM, Carazzolle MF, Dias SMG. BMC Cancer. 2017 Nov 7;17(1):727. doi: 10.1186/s12885-017-3726-2. 10.1186/s12885-017-3726-2 [pii] PubMed 29115931