Skip to main content
Addgene

pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D
(Plasmid #110302)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110302 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459)
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #48139
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p53-binding protein 1
  • gRNA/shRNA sequence
    GGACTGCTAGGAACGATAAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    TP53BP1 (a.k.a. 53BP1, TDRD30, p202, p53BP1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D was a gift from Chris Kok-Lung Chan (Addgene plasmid # 110302 ; http://n2t.net/addgene:110302 ; RRID:Addgene_110302)
  • For your References section:

    53BP1 can limit sister-chromatid rupture and rearrangements driven by a distinct ultrafine DNA bridging-breakage process. Tiwari A, Addis Jones O, Chan KL. Nat Commun. 2018 Feb 14;9(1):677. doi: 10.1038/s41467-018-03098-y. 10.1038/s41467-018-03098-y [pii] PubMed 29445165