Skip to main content
Addgene

pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
(Plasmid #110300)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110300 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459)
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #48139
  • Modifications to backbone
    Puromycin is replaced by Neomycin resistant gene
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p53-binding protein 1
  • gRNA/shRNA sequence
    GGACTGCTAGGAACGATAAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    TP53BP1 (a.k.a. 53BP1, TDRD30, p202, p53BP1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D was a gift from Chris Kok-Lung Chan (Addgene plasmid # 110300 ; http://n2t.net/addgene:110300 ; RRID:Addgene_110300)

  • For your References section:

    PLK1 facilitates chromosome biorientation by suppressing centromere disintegration driven by BLM-mediated unwinding and spindle pulling. Addis Jones O, Tiwari A, Olukoga T, Herbert A, Chan KL. Nat Commun. 2019 Jun 28;10(1):2861. doi: 10.1038/s41467-019-10938-y. 10.1038/s41467-019-10938-y PubMed 31253795
Related items:
Commonly requested with: