ins:BB1.0L; cryaa:RFP
(Plasmid #110283)

• Purpose: A zebrafish insulin promoter driving the Brainbow (BB1.0L) cassette. Contains red eye marker, and is flanked with I-SceI sites.
• Depositing Lab: Nikolay Ninov
• Publication: Singh et al Nat Commun. 2017 Sep 22;8(1):664. doi: 10.1038/s41467-017-00461-3.

Backbone

• Vector backbone: pKS-ins:MCS; cryaa:RFP
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 9940
• Vector type: Zebrafish

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Brainbow1.0L
• Species: Synthetic
• Insert Size (bp): 3300
• Promoter: insulin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (destroyed during cloning)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: ACACCCTGGTCATCATCCTG

Resource Information

• Supplemental Documents:
  • ins_BB1_0L_red_eye_reporter.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Brainbow1.0L fragment obtained from Addgene Plasmid Number: 18725 (Thy1-Brainbow-1.0 L).