Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Designed VEGF-binding scFv G6des13
(Plasmid #110213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110213 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCTcon2
  • Backbone size w/o insert (bp) 6168
  • Total vector size (bp) 6960
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G6des13
  • Species
    Synthetic
  • Insert Size (bp)
    792
  • Mutation
    L A43P, L Q89L, L T94D, L P95T, H Y59H, H Y95F
  • Tag / Fusion Protein
    • cmyc tag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer GCAGCCCCATAAACACACAGTATG
  • 3′ sequencing primer GGAGAAATGAAAAGTATATTGTATTTTGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Designed VEGF-binding scFv G6des13 was a gift from Sarel Fleishman (Addgene plasmid # 110213 ; http://n2t.net/addgene:110213 ; RRID:Addgene_110213)
  • For your References section:

    Optimizing antibody affinity and stability by the automated design of the variable light-heavy chain interfaces. Warszawski S, Borenstein Katz A, Lipsh R, Khmelnitsky L, Ben Nissan G, Javitt G, Dym O, Unger T, Knop O, Albeck S, Diskin R, Fass D, Sharon M, Fleishman SJ. PLoS Comput Biol. 2019 Aug 23;15(8):e1007207. doi: 10.1371/journal.pcbi.1007207. eCollection 2019 Aug. 10.1371/journal.pcbi.1007207 PubMed 31442220