Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCR-II-TOPO-mitfa_LexPR-2A-Cerulean-SV40pA-FRT-Kan-FRT: Sequences,
(Plasmid #110201)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110201 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR-II-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Kanamycin is used to verify recombination into an acceptor BAC
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LexPR transactivator - 2A - Cerulean
  • Alt name
    LexPR-Cerulean
  • Species
    Synthetic
  • Insert Size (bp)
    4798
  • Tag / Fusion Protein
    • Cerulean (C terminal on insert)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR-II-TOPO-mitfa_LexPR-2A-Cerulean-SV40pA-FRT-Kan-FRT: Sequences, was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 110201 ; http://n2t.net/addgene:110201 ; RRID:Addgene_110201)
  • For your References section:

    Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes. Kenyon A, Gavriouchkina D, Zorman J, Chong-Morrison V, Napolitani G, Cerundolo V, Sauka-Spengler T. Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056. 10.1242/dmm.030056 PubMed 29666124