pEGFP-N1_MeCP2(R306C)
(Plasmid
#110188)
-
PurposeExpression of mouse MeCP2 (R306C) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4680
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMeCP2_e2 FL [R306C] (mouse cDNA)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1469
-
MutationArg 306 Cys
-
Entrez GeneMecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer aaatgtcgtaacaactccgc
- 3′ sequencing primer acaaaccacaactagaatgcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1_MeCP2(R306C) was a gift from Adrian Bird (Addgene plasmid # 110188 ; http://n2t.net/addgene:110188 ; RRID:Addgene_110188) -
For your References section:
Radically truncated MeCP2 rescues Rett syndrome-like neurological defects. Tillotson R, Selfridge J, Koerner MV, Gadalla KKE, Guy J, De Sousa D, Hector RD, Cobb SR, Bird A. Nature. 2017 Oct 19;550(7676):398-401. doi: 10.1038/nature24058. Epub 2017 Oct 11. 10.1038/nature24058 PubMed 29019980