pSET-dCas9-actII-4-NT-S1
(Plasmid #110185)

• Purpose: Repression of gene expression in Streptomyces by CRISPRi
• Depositing Lab: Yinhua Lu
• Publication: Zhao et al Biotechnol J. 2018 Jun 3. doi: 10.1002/biot.201800121.

Backbone

• Vector backbone: pSET152
• Backbone size w/o insert (bp): 5715
• Vector type: Bacterial Expression, CRISPR ; i

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dCas9
• Species: Synthetic; artificially synthesized, codon optimized gene from S. pyogenes
• Insert Size (bp): 4107
• Mutation: D10A, H840A
• Promoter: ermE*p

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: pSET152-F (GATGTAGGAGGGCGTGGATATG)
• 3′ sequencing primer: pSET152-R (CCCAATACGCAAACCGCCTC)

Gene/Insert 2

• Gene/Insert name: sgRNA
• Insert Size (bp): 106
• Promoter: J23119

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • pSET-dCas9-actII-4-NT-S1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry