Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET29b-PD-G817A
(Plasmid #110174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110174 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-29 b (+)
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5299
  • Total vector size (bp) 7830
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Propanediol Dehydratase
  • Alt name
    PD
  • Alt name
    B12-Independent Propanediol Dehydratase
  • Species
    Roseburia inulinivorans strain A2-194
  • Insert Size (bp)
    2530
  • Mutation
    G817A mutant
  • GenBank ID
    WP_007885173.1
  • Promoter T7
  • Tags / Fusion Proteins
    • S-tag (N terminal on backbone)
    • His6 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b-PD-G817A was a gift from Emily Balskus (Addgene plasmid # 110174 ; http://n2t.net/addgene:110174 ; RRID:Addgene_110174)
  • For your References section:

    A prominent glycyl radical enzyme in human gut microbiomes metabolizes trans-4-hydroxy-l-proline. Levin BJ, Huang YY, Peck SC, Wei Y, Martinez-Del Campo A, Marks JA, Franzosa EA, Huttenhower C, Balskus EP. Science. 2017 Feb 10;355(6325). pii: 355/6325/eaai8386. doi: 10.1126/science.aai8386. 10.1126/science.aai8386 PubMed 28183913