Skip to main content
Addgene

pCC336
(Plasmid #110167)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110167 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCFJ910
  • Backbone manufacturer
    Addgene Plasmid #44481
  • Backbone size w/o insert (bp) 5496
  • Total vector size (bp) 15703
  • Vector type
    Worm Expression ; miniMos transposon
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERK-KTR(S43E,T55E,T62E)-mClover-T2A-mCherry-H2B
  • Alt name
    ERK-nKTR(EEE)
  • Alt name
    ERK-KTR(EEE)-mClover
  • Species
    H. sapiens (human), C. elegans (nematode), Synthetic
  • Insert Size (bp)
    2253
  • Mutation
    Phospho-acceptor sites mutated: S43E, T55E, T62E. Additionally, R61K change made in ERK-KTR CDS.
  • Promoter lin-31 promoter/enhancer
  • Tags / Fusion Proteins
    • mClover (C terminal on insert)
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer caggaaacagctatgaccatg
  • 3′ sequencing primer tgtaaaacgacggccagt
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Original ERK-KTR-mClover coding sequence was derived from pENTR-ERKKTRClover, Addgene Plasmid #59138.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Glutamic acid substitutions made in ERK-KTR-mClover to produce phospho-mimetic control reporter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCC336 was a gift from Iva Greenwald (Addgene plasmid # 110167 ; http://n2t.net/addgene:110167 ; RRID:Addgene_110167)
  • For your References section:

    A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification. de la Cova C, Townley R, Regot S, Greenwald I. Dev Cell. 2017 Sep 11;42(5):542-553.e4. doi: 10.1016/j.devcel.2017.07.014. Epub 2017 Aug 17. 10.1016/j.devcel.2017.07.014 PubMed 28826819
Commonly requested with: