pCC335
(Plasmid #110166)

• Purpose: miniMos vector expresses ERKKTR(S43A,T55A,T62A)-mClover and mCherry-H2B in C. elegans VPCs; use as control for pCC324 (Contains Neomycin resistance)
• Depositing Lab: Iva Greenwald
• Publication: de la Cova et al Dev Cell. 2017 Sep 11;42(5):542-553.e4. doi: 10.1016/j.devcel.2017.07.014. Epub 2017 Aug 17.

Backbone

• Vector backbone: pCFJ910
• Backbone manufacturer: Addgene Plasmid #44481
• Backbone size w/o insert (bp): 5496
• Total vector size (bp): 15703
• Vector type: Worm Expression ; miniMos transposon
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ERK-KTR(S43A,T55A,T62A)-mClover-T2A-mCherry-H2B
• Alt name: ERK-nKTR(AAA)
• Alt name: ERK-KTR(AAA)-mClover
• Species: H. sapiens (human), C. elegans (nematode), Synthetic
• Insert Size (bp): 2253
• Mutation: Phospho-acceptor sites mutated: S43A, T55A, T62A. Additionally, R61K change made in ERK-KTR CDS.
• Promoter: lin-31 promoter/enhancer
• Tags / Fusion Proteins:
  • mClover (C terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caggaaacagctatgaccatg
• 3′ sequencing primer: tgtaaaacgacggccagt

Resource Information

• Supplemental Documents:
  • pCC335.ape
• A portion of this plasmid was derived from a plasmid made by: Original ERK-KTR-mClover coding sequence was derived from pENTR-ERKKTRClover, Addgene Plasmid #59138.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alanine substitutions made in ERK-KTR-mClover to produce unphosphorylated control reporter.