Skip to main content
Addgene

Hy_pMT Flag-Hel25E MUT
(Plasmid #110122)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110122 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Hy_pMT
  • Total vector size (bp) 8496
  • Vector type
    Insect Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Hel25E
  • Species
    D. melanogaster (fly)
  • Mutation
    4 mutations (KKLN motif changed to RSFS)
  • Entrez Gene
    Hel25E (a.k.a. Dmel_CG7269, CG7269, Dbp25F, DmRH4, Dmel\CG7269, HEL, HEL25E, Hel, UAP56, Uap56, WM6, Wm6, dHel25E, hel, jf26, l(2)25Eb, l(2)gdh-12, l(2)gdh12, l(2)jf26, l(2)k11511, sz, uap56)
  • Promoter Metallothionein Promoter (pMT)
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CACTCGAATTTGGAGCCGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hy_pMT Flag-Hel25E MUT was a gift from Jeremy Wilusz (Addgene plasmid # 110122 ; http://n2t.net/addgene:110122 ; RRID:Addgene_110122)
  • For your References section:

    A length-dependent evolutionarily conserved pathway controls nuclear export of circular RNAs. Huang C, Liang D, Tatomer DC, Wilusz JE. Genes Dev. 2018 May 17. pii: gad.314856.118. doi: 10.1101/gad.314856.118. 10.1101/gad.314856.118 PubMed 29773557