Hy_pMT Flag-Hel25E K91N
(Plasmid
#110121)
-
PurposeExpresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHy_pMT
- Total vector size (bp) 8496
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHel25E
-
SpeciesD. melanogaster (fly)
-
MutationK91N mutation
-
Entrez GeneHel25E (a.k.a. Dmel_CG7269, CG7269, Dbp25F, DmRH4, Dmel\CG7269, HEL, HEL25E, Hel, UAP56, Uap56, WM6, Wm6, dHel25E, hel, jf26, l(2)25Eb, l(2)gdh-12, l(2)gdh12, l(2)jf26, l(2)k11511, sz, uap56)
- Promoter Metallothionein Promoter (pMT)
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMT Flag-Hel25E K91N was a gift from Jeremy Wilusz (Addgene plasmid # 110121 ; http://n2t.net/addgene:110121 ; RRID:Addgene_110121) -
For your References section:
A length-dependent evolutionarily conserved pathway controls nuclear export of circular RNAs. Huang C, Liang D, Tatomer DC, Wilusz JE. Genes Dev. 2018 May 17. pii: gad.314856.118. doi: 10.1101/gad.314856.118. 10.1101/gad.314856.118 PubMed 29773557