Hy_pMT Flag-Hel25E D193E
(Plasmid #110120)

• Purpose: Expresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinity
• Depositing Lab: Jeremy Wilusz
• Publication: Huang et al Genes Dev. 2018 May 17. pii: gad.314856.118. doi: 10.1101/gad.314856.118.

Backbone

• Vector backbone: Hy_pMT
• Total vector size (bp): 8496
• Vector type: Insect Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Hel25E
• Species: D. melanogaster (fly)
• Mutation: D193E mutation
• Entrez Gene: Hel25E (a.k.a. Dmel_CG7269, CG7269, Dbp25F, DmRH4, Dmel\CG7269, HEL, HEL25E, Hel, UAP56, Uap56, WM6, Wm6, dHel25E, hel, jf26, l(2)25Eb, l(2)gdh-12, l(2)gdh12, l(2)jf26, l(2)k11511, sz, uap56)
• Promoter: Metallothionein Promoter (pMT)
• Tag / Fusion Protein:
  • Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CACTCGAATTTGGAGCCGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry