Hy_pMT dati MCS Exon
(Plasmid
#110119)
-
PurposeExpression plasmid for expressing circular RNAs of a desired sequence in Drosophila using the dati flanking introns to drive backsplicing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHy_pMT
- Total vector size (bp) 8434
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedati
-
Alt nameCG2052
-
SpeciesD. melanogaster (fly)
-
Entrez Genedati (a.k.a. Dmel_CG2052, CG10204, CG2052, DmLin29, Dmel\CG2052, Lin29)
- Promoter Metallothionein Promoter (pMT)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CACTCGAATTTGGAGCCGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor notes discrepancies found in Addgene QC sequence are not of functional concern
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pMT dati MCS Exon was a gift from Jeremy Wilusz (Addgene plasmid # 110119 ; http://n2t.net/addgene:110119 ; RRID:Addgene_110119) -
For your References section:
A length-dependent evolutionarily conserved pathway controls nuclear export of circular RNAs. Huang C, Liang D, Tatomer DC, Wilusz JE. Genes Dev. 2018 May 17. pii: gad.314856.118. doi: 10.1101/gad.314856.118. 10.1101/gad.314856.118 PubMed 29773557