A3Ai E72A-Cas9n-UGI-NLS
(Plasmid #109430)

• Purpose: Expresses catalytically inactive human APOBEC3A with an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.
• Depositing Lab: Reuben Harris
• Publication: St Martin et al Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332.

Backbone

• Vector backbone: BE3
• Backbone manufacturer: David Liu
• Backbone size w/o insert (bp): 7825
• Total vector size (bp): 9325
• Modifications to backbone: Removed rat APOBEC1 and inserted human APOBEC3A E72A catalytic mutant
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A E72A Catalytic Mutant
• Alt name: APOBEC3A E72A Catalytic Mutant
• Alt name: A3A E72A
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• Mutation: Insertion of an L1 intron into the coding sequence of A3A to prevent mutation in E. coli, site-directed mutant E72A to make A3A catalytically inactive
• Entrez Gene: APOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: CAAAGAAGGAACCAGGTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry