A3Bi-ctd E255A -Cas9n-UGI-NLS
(Plasmid #109429)

• Purpose: Expresses the C-terminal catalytically inactive mutant of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.
• Depositing Lab: Reuben Harris
• Publication: St Martin et al Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332.

Backbone

• Vector backbone: BE3
• Backbone manufacturer: David Liu
• Backbone size w/o insert (bp): 7822
• Total vector size (bp): 9294
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Apolipoprotein mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal Doman E255A Catalytic Mutant
• Alt name: APOBEC3B C-terminal Domain E255A
• Alt name: A3Bctd E5255A
• Alt name: A3B ctd CM
• Species: H. sapiens (human)
• Insert Size (bp): 1472
• Mutation: Insertion of an L1 intron into the coding sequence of A3B to prevent mutation in E. coli, only cloned catalytically dead mutant C-terminal domain, site-directed E255A to make the protein catalytically inactive
• Entrez Gene: APOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: CAAAGAAGGAACCAGGTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry