ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
(Plasmid #109428)

• Purpose: A lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.
• Depositing Lab: Reuben Harris
• Publication: St Martin et al Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332.

Backbone

• Vector backbone: HIV-1 NL4-3
• Backbone size w/o insert (bp): 9269
• Total vector size (bp): 10814
• Modifications to backbone: Removed HIV-1 nef, vif, vpr, and part of env. Inserted CMV mCherry T2A GFP with a 43 base pair insertion in mCherry.
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry T2A GFP
• Species: Synthetic
• Insert Size (bp): 1545
• Mutation: Inserted 43 base pairs into mCherry to create reporter
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: ctggctaccggtatggtgagcaagggcgagg
• 3′ sequencing primer: CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry