Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
(Plasmid #109428)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109428 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    HIV-1 NL4-3
  • Backbone size w/o insert (bp) 9269
  • Total vector size (bp) 10814
  • Modifications to backbone
    Removed HIV-1 nef, vif, vpr, and part of env. Inserted CMV mCherry T2A GFP with a 43 base pair insertion in mCherry.
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry T2A GFP
  • Species
    Synthetic
  • Insert Size (bp)
    1545
  • Mutation
    Inserted 43 base pairs into mCherry to create reporter
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ctggctaccggtatggtgagcaagggcgagg
  • 3′ sequencing primer CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP) was a gift from Reuben Harris (Addgene plasmid # 109428 ; http://n2t.net/addgene:109428 ; RRID:Addgene_109428)
  • For your References section:

    A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667