-
PurposeA lentiviral backbone expressing mCherry-T2A-eGFP off of a CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109427 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHIV-1 NL4-3
- Backbone size w/o insert (bp) 9268
-
Modifications to backboneRemoved gag-pol, vif, vpr, and part of env from HIV-1 NL4-3 backbone. Inserted mCherry T2A GFP.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry T2A GFP
-
SpeciesSynthetic
-
Insert Size (bp)1503
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CTGGCTACCGGTATGGTGAGCAAGGGCGAGG
- 3′ sequencing primer CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plenti-CMV-mCherry-T2A-GFP was a gift from Reuben Harris (Addgene plasmid # 109427 ; http://n2t.net/addgene:109427 ; RRID:Addgene_109427) -
For your References section:
A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667