Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

A3Ai-Cas9n-UGI-NLS
(Plasmid #109425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109425 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BE3
  • Backbone manufacturer
    David Liu
  • Backbone size w/o insert (bp) 7825
  • Total vector size (bp) 9325
  • Modifications to backbone
    Removed rat APOBEC1 and replaced with human APOBEC3A
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A
  • Alt name
    APOBEC3A
  • Alt name
    A3A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Mutation
    Insertion of an L1 intron into the coding sequence of A3A to prevent mutation in E. coli
  • Entrez Gene
    APOBEC3A
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer CAAAGAAGGAACCAGGTCCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3Ai-Cas9n-UGI-NLS was a gift from Reuben Harris (Addgene plasmid # 109425 ; http://n2t.net/addgene:109425 ; RRID:Addgene_109425)
  • For your References section:

    A fluorescent reporter for quantification and enrichment of DNA editing by APOBEC-Cas9 or cleavage by Cas9 in living cells. St Martin A, Salamango D, Serebrenik A, Shaban N, Brown WL, Donati F, Munagala U, Conticello SG, Harris RS. Nucleic Acids Res. 2018 May 9. pii: 4994269. doi: 10.1093/nar/gky332. 10.1093/nar/gky332 PubMed 29746667