pET21d-myc-BirA
(Plasmid #109424)

• Purpose: Bacterial expression of biotin ligase (BirA) with an N-terminal myc epitope
• Depositing Lab: Martin Spiess
• Publication: Buser et al Proc Natl Acad Sci U S A. 2018 Jul 3;115(27):E6227-E6236. doi: 10.1073/pnas.1801865115. Epub 2018 Jun 18.

Backbone

• Vector backbone: pET21d
• Backbone manufacturer: Merck - Novagen
• Total vector size (bp): 6253
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: BirA
• Alt name: biotin ligase
• Insert Size (bp): 1005
• Entrez Gene: birA (a.k.a. b3973, ECK3965, bioR, dhbB)
• Promoter: T7
• Tag / Fusion Protein:
  • myc (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry