pET24a-VHH-tev-std
(Plasmid #109423)

• Purpose: Bacterial expression of a functionalized anti-GFP (VHH) nanobody with a TEV site. VHH-tev-std is flanked by an N-terminal T7 epitope, and a C-terminal cassette composed of HA, BAP and a His6 epitope
• Depositing Lab: Martin Spiess
• Publication: Buser et al Proc Natl Acad Sci U S A. 2018 Jul 3;115(27):E6227-E6236. doi: 10.1073/pnas.1801865115. Epub 2018 Jun 18.

Backbone

• Vector backbone: pET24a
• Backbone manufacturer: Merck - Novagen
• Total vector size (bp): 5765
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: anti-GFP nanobody fused to a T7, TEV cleavage site, HA, BAP and His6 epitope
• Alt name: VHHGFP4
• Species: Synthetic
• Insert Size (bp): 558
• Promoter: T7
• Tags / Fusion Proteins:
  • T7 (N terminal on insert)
  • HA (C terminal on insert)
  • BAP (C terminal on insert)
  • His6 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry