Skip to main content
Addgene

pET24a-VHH-1xTS
(Plasmid #109418)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109418 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET24a
  • Backbone manufacturer
    Merck - Novagen
  • Total vector size (bp) 5771
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    anti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
  • Alt name
    VHHGFP4
  • Alt name
    tyrosine sulfation sequence
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    564
  • Promoter T7
  • Tags / Fusion Proteins
    • T7 (N terminal on insert)
    • HA (C terminal on insert)
    • BAP (C terminal on insert)
    • His6 (C terminal on insert)
    • Tyrosine sulfation (TS) sequence from rat proCCK (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET24a-VHH-1xTS was a gift from Martin Spiess (Addgene plasmid # 109418 ; http://n2t.net/addgene:109418 ; RRID:Addgene_109418)

  • For your References section:

    A versatile nanobody-based toolkit to analyze retrograde transport from the cell surface. Buser DP, Schleicher KD, Prescianotto-Baschong C, Spiess M. Proc Natl Acad Sci U S A. 2018 Jul 3;115(27):E6227-E6236. doi: 10.1073/pnas.1801865115. Epub 2018 Jun 18. 10.1073/pnas.1801865115 PubMed 29915061
Related items: