pMIA3
(Plasmid #109399)

• Purpose: (Empty Backbone) Expresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSB
• Depositing Lab: Roger Foo
• Publication: Ang et al Cell Rep. 2018 Feb 20;22(8):2190-2205. doi: 10.1016/j.celrep.2018.01.087.

Backbone

• Vector backbone: px330 (addgene #42230)
• Backbone size (bp): 4000
• Modifications to backbone: Promoter was changed to EF1a and pUC fragment was modified.
• Vector type: Mammalian Expression, CRISPR
• Promoter: EF1a
• Tags / Fusion Proteins:
  • mRuby2 (N terminal on insert)
  • mtp53dn (N terminal on insert)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pMIA3 1sg-eSpCas9-2AmRuby2-2Amp53DD.gbk
  • CRISPR targeting of hES cells
• A portion of this plasmid was derived from a plasmid made by: eSpCas9 is modified from px330 with the point mutations described by Slaymaker et.al., Science, (2016) using a gBlock. mRuby2 was amplified from a gBlock based on the sequence from Lam et al., Nat Meth, (2012) and mtp53 was amplified from Addgene plasmid #41856.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pMIA3 allows for higher survival of hES cells after Cas9 DSB targeting, and thus reduces the number for clones required to screen for desired editing.