pcDNA3 hML23Cm6
(Plasmid #109368)

• Purpose: Human melanopsin chimera with intracellular loops 2-3 and C-terminus from mGluR6
• Depositing Lab: Robert Lucas
• Publication: Ballister et al BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5366
• Total vector size (bp): 6410
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Melanopsin-mGluR6 chimera
• Alt name: hML23Cm6
• Species: H. sapiens (human)
• Insert Size (bp): 1119
• GenBank ID: NM_033282, NM_000843.3
• Entrez Gene: OPN4 (a.k.a. MOP)
• Entrez Gene: GRM6 (a.k.a. CSNB1B, GPRC1F, MGLUR6, mGlu6)
• Promoter: CMV
• Tag / Fusion Protein:
  • 1D4 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAGGTCTATATAAGCAGAGC
• 3′ sequencing primer: ggcaccttccagggtcaagg

Resource Information

• Supplemental Documents:
  • hML23Cm6.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry