pLenti-LbCpf1-U6_FlipArray
(Plasmid #109349)

• Purpose: Lentiviral vector to express Cpf1 from EFS promoter, as well as a Cpf1 FlipArray from U6 promoter.
• Depositing Lab: Sidi Chen
• Publication: Chow et al Nat Commun. 2018 May 15;9(1):1903. doi: 10.1038/s41467-018-04158-z.

Backbone

• Vector backbone: pY109
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 12630
• Total vector size (bp): 12720
• Modifications to backbone: Modified U6 expression casette to be used for FlipArray.
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox, CRISPR, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: U6-FlipArray
• Alt name: U6-DR-lox66-DR-BsmbIx2-lox71'-6T
• Species: Synthetic
• Insert Size (bp): 137
• Promoter: U6

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagggcctatttcccatgat
• 3′ sequencing primer: gggacagcagagatccagtttggT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry