Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBN396
(Plasmid #109326)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109326 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBN338
  • Backbone manufacturer
    Askjaer lab
  • Total vector size (bp) 10791
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mex-5
  • Alt name
    mex-5 promoter
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    486
  • Entrez Gene
    mex-5 (a.k.a. CELE_W02A2.7)
  • Promoter mex-5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer gctctgcgagaaatagtacagca
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBN396 was a gift from Peter Askjaer (Addgene plasmid # 109326 ; http://n2t.net/addgene:109326 ; RRID:Addgene_109326)
  • For your References section:

    Efficient FLP-mediated germ-line recombination in C. elegans. Macias-Leon J, Askjaer P. MicroPubl Biol. 2018 Mar 19;2018:10.17912/W2G66S. doi: 10.17912/W2G66S. 10.17912/W2G66S PubMed 32550382