Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pU6-crRNA(TBK1)
(Plasmid #109322)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 109322 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Custom
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry-KASH
  • gRNA/shRNA sequence
    GCCAAGATGCAGAGCACTTCTAA (TBK1)
  • Species
    H. sapiens (human)
  • Entrez Gene
    TBK1 (a.k.a. FTDALS4, IIAE8, NAK, T2K)
  • Promoter hSyn

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-crRNA(TBK1) was a gift from Feng Zhang (Addgene plasmid # 109322 ; http://n2t.net/addgene:109322 ; RRID:Addgene_109322)
  • For your References section:

    Effects of 3D culturing conditions on the transcriptomic profile of stem-cell-derived neurons. Tekin H, Simmons S, Cummings B, Gao L, Adiconis X, Hession CC, Ghoshal A, Dionne D, Choudhury SR, Yesilyurt V, Sanjana NE, Shi X, Lu C, Heidenreich M, Pan JQ, Levin JZ, Zhang F. Nat Biomed Eng. 2018 Jul;2(7):540-554. doi: 10.1038/s41551-018-0219-9. Epub 2018 Apr 9. 10.1038/s41551-018-0219-9 PubMed 30271673