1476_pAAV-U6-SA-mMttp-gRNA-N21-HLP-SACas9-spA
(Plasmid
#109315)
-
PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against Mttp
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepEMBL8
- Backbone size w/o insert (bp) 6967
- Total vector size (bp) 6977
-
Modifications to backboneSaCas9 was cloned from Addgene Plasmid #61593
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMttp gRNA
-
gRNA/shRNA sequencegtggacgttgtgttactgtgg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CCTTCATATTTGCATATACGATACAAGGCTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1476_pAAV-U6-SA-mMttp-gRNA-N21-HLP-SACas9-spA was a gift from William Lagor (Addgene plasmid # 109315 ; http://n2t.net/addgene:109315 ; RRID:Addgene_109315) -
For your References section:
A Self-Deleting AAV-CRISPR System for In Vivo Genome Editing. Li A, Lee CM, Hurley AE, Jarrett KE, De Giorgi M, Lu W, Balderrama KS, Doerfler AM, Deshmukh H, Ray A, Bao G, Lagor WR. Mol Ther Methods Clin Dev. 2018 Dec 6;12:111-122. doi: 10.1016/j.omtm.2018.11.009. eCollection 2019 Mar 15. 10.1016/j.omtm.2018.11.009 PubMed 30619914